>Transcript: g16550593 | From: 968 To: 1036
GCGCTGAAGTATGCCTTCCAGACCCACGACCGCCTGTGCTTTGTGATGGAGTATGCCAACGGGGGTGAG