>Transcript: g16550593 | From: 902 To: 967
GATGAAGTCGCTCACACAGTCACCGAGAGCCGGGTCCTCCAGAACACCAGGCACCCGTTCCTCACT