>Transcript: g16550593 | From: 770 To: 901
ACCATGAATGACTTCGACTATCTCAAACTCCTTGGCAAGGGAACCTTTGGCAAAGTCATCCTGGTGCGGGAGAAGGCCACTGGCCGCTACTATGCCATGAAGATCCTGCGGAAGGAAGTCATCATTGCCAAG