>Transcript: g16550593 | From: 1592 To: 1694
CTCCTGCCACCCTTCAAACCTCAGGTCACGTCCGAGGTCGACACAAGGTACTTCGATGATGAATTTACCGCCCAGTCCATCACAATCACACCCCCTGACCGCT