>Transcript: g16550593 | From: 1504 To: 1591
GCTTGGTGGGGGGCCCAGCGATGCCAAGGAGGTCATGGAGCACAGGTTCTTCCTCAGCATCAACTGGCAGGACGTGGTCCAGAAGAAG