The graphical view of miRNA target site on the transcript.


Exon boundary/UTR region/CDS region on the transcript
   
NM_001626 Sequence View
hsa-miR-17*  
miRNA target sites relative to the transcript

Summary miRNA target site
miRNA Pos. on Gene Transcript (Tx.) Pos. on Tx. Tx. Region Exon Type Conservation Target
Accessibility
MFE Alignment Score Alignment Seed Type
5'UTR CDS 3'UTR CS AS
hsa-miR-17* 51636 - 51657 NM_001626 1857 - 1878       0.000 0.000 -12.30  120.00
 miRNA 3'-gauguucacggaaguGACGUCa-5'
                      |||||| 
  mRNA 5'-gcaccccagcggcccCUGCAGc-3'
6mer
hsa-miR-17* 52028 - 52049 NM_001626 2249 - 2270       0.001 0.000 -15.20  136.00
 miRNA 3'-gaugUUCACGGAAG----UGACGUCa-5'
           |:| ||| |:    :|||||| 
  mRNA 5'-----AGGGGCCCUUGGGAGCUGCAGg-3'
6mer
hsa-miR-17* 52502 - 52523 NM_001626 2723 - 2744       0.000 0.000 -16.40  122.00
 miRNA 3'-gauGUUCACGG-----AAGUGACGUCa-5'
          | || |||     ||  |||||| 
  mRNA 5'----CCAGGGCCCCACGUU--CUGCAGc-3'
6mer
hsa-miR-17* 54141 - 54162 NM_001626 4362 - 4383       0.006 0.000 -15.10  134.00
 miRNA 3'-gaugUUCACGGAAGUGACGUCa-5'
           ::|| ||   :|||||| 
  mRNA 5'-gaugGGGUCCCACAGCUGCAGc-3'
6mer
hsa-miR-17* 54548 - 54569 NM_001626 4769 - 4790       0.000 0.000 -15.40  135.00
 miRNA 3'-gauGUUCACGGA-AGUGACGUCa-5'
          ||:| |::|   :|||||| 
  mRNA 5'--ccCAGGAGUUUGAGGCUGCAGu-3'
6mer
hsa-miR-17* 54577 - 54598 NM_001626 4798 - 4819       0.023 0.000 -17.60  156.00
 miRNA 3'-gaugUUCACG----GAAGUGACGUCa-5'
           :| |||    || |||||||| 
  mRNA 5'-----GAUUGCGGCACUGCACUGCAGc-3'
7mer-m8
*CS: constitutively spliced exon
*AS: alternatively spliced exon

The sequence view of miRNA target site on the transcript.


Transcript sequence
1   
CGGGGGGGGCCGCGCCGTGCTAGCCGTTGGGCCTGCCTCGGAGGAGGCGTCGCCGCCGCCGCTGCCGCTG
   70
71   
CCGGCGCCGTTGCCGCTGCCGGGAAACACAAGGAAAGGGAACCAGCGCAGCGTGGCGATGGGCGGGGGTA
   140
141   
GAGCCCCGCCGGAGAGGCTGGGCGGCTGCCGGTGACAGACTGTGCCCTGTCCACGGTGCCTCCTGCATGT
   210
211   
CCTGCTGCCCTGAGCTGTCCCGAGCTAGGTGACAGCGTACCACGCTGCCACCATGAATGAGGTGTCTGTC
   280
281   
ATCAAAGAAGGCTGGCTCCACAAGCGTGGTGAATACATCAAGACCTGGAGGCCACGGTACTTCCTGCTGA
   350
351   
AGAGCGACGGCTCCTTCATTGGGTACAAGGAGAGGCCCGAGGCCCCTGATCAGACTCTACCCCCCTTAAA
   420
421   
CAACTTCTCCGTAGCAGAATGCCAGCTGATGAAGACCGAGAGGCCGCGACCCAACACCTTTGTCATACGC
   490
491   
TGCCTGCAGTGGACCACAGTCATCGAGAGGACCTTCCACGTGGATTCTCCAGACGAGAGGGAGGAGTGGA
   560
561   
TGCGGGCCATCCAGATGGTCGCCAACAGCCTCAAGCAGCGGGCCCCAGGCGAGGACCCCATGGACTACAA
   630
631   
GTGTGGCTCCCCCAGTGACTCCTCCACGACTGAGGAGATGGAAGTGGCGGTCAGCAAGGCACGGGCTAAA
   700
701   
GTGACCATGAATGACTTCGACTATCTCAAACTCCTTGGCAAGGGAACCTTTGGCAAAGTCATCCTGGTGC
   770
771   
GGGAGAAGGCCACTGGCCGCTACTACGCCATGAAGATCCTGCGGAAGGAAGTCATCATTGCCAAGGATGA
   840
841   
AGTCGCTCACACAGTCACCGAGAGCCGGGTCCTCCAGAACACCAGGCACCCGTTCCTCACTGCGCTGAAG
   910
911   
TATGCCTTCCAGACCCACGACCGCCTGTGCTTTGTGATGGAGTATGCCAACGGGGGTGAGCTGTTCTTCC
   980
981   
ACCTGTCCCGGGAGCGTGTCTTCACAGAGGAGCGGGCCCGGTTTTATGGTGCAGAGATTGTCTCGGCTCT
   1050
1051   
TGAGTACTTGCACTCGCGGGACGTGGTATACCGCGACATCAAGCTGGAAAACCTCATGCTGGACAAAGAT
   1120
1121   
GGCCACATCAAGATCACTGACTTTGGCCTCTGCAAAGAGGGCATCAGTGACGGGGCCACCATGAAAACCT
   1190
1191   
TCTGTGGGACCCCGGAGTACCTGGCGCCTGAGGTGCTGGAGGACAATGACTATGGCCGGGCCGTGGACTG
   1260
1261   
GTGGGGGCTGGGTGTGGTCATGTACGAGATGATGTGCGGCCGCCTGCCCTTCTACAACCAGGACCACGAG
   1330
1331   
CGCCTCTTCGAGCTCATCCTCATGGAAGAGATCCGCTTCCCGCGCACGCTCAGCCCCGAGGCCAAGTCCC
   1400
1401   
TGCTTGCTGGGCTGCTTAAGAAGGACCCCAAGCAGAGGCTTGGTGGGGGGCCCAGCGATGCCAAGGAGGT
   1470
1471   
CATGGAGCACAGGTTCTTCCTCAGCATCAACTGGCAGGACGTGGTCCAGAAGAAGCTCCTGCCACCCTTC
   1540
1541   
AAACCTCAGGTCACGTCCGAGGTCGACACAAGGTACTTCGATGATGAATTTACCGCCCAGTCCATCACAA
   1610
1611   
TCACACCCCCTGACCGCTATGACAGCCTGGGCTTACTGGAGCTGGACCAGCGGACCCACTTCCCCCAGTT
   1680
1681   
CTCCTACTCGGCCAGCATCCGCGAGTGAGCAGTCTGCCCACGCAGAGGACGCACGCTCGCTGCCATCACC
   1750
1751   
GCTGGGTGGTTTTTTCCCCCTAACTTTTTACTTAGCCTTTTTGGTTTGTGTCCCCACCCCCACCTCCTCA
   1820
1821   
CCCCCTTTCCAGTTCTTCTTCAGGCCCCTCCCAGACGCACCCCAGCGGCCCCTGCAGCCCCTGCCTCCAG
   1890
1891   
CCTCCAGCCTCACCTTTGTGCCCAGACTCGCATTTGGAAGACTCCACCTCCCGCCCAGGCCTGGGCTGTT
   1960
1961   
GGGCGGTTGGAGATTCAGGTTTTAATCCACACAAGCCCCAGTGAGGGGTGAAGCATGGCGCCTGGGGCCT
   2030
2031   
GCCTGAGTTTCTGGCCTGGGTGTCGTGCTGGTGTCTGCCTCCGCGCTGCTGCATCTGGACGAAGGCTGCC
   2100
2101   
TTCTGGTGGGACGCGACACCCGGCAGACAGTGGTGCTGCCTTCCAGGCCCCGTGGCCTAGGCTCGGAGTG
   2170
2171   
GCCAGGCACGGGGCGGTCCAATCCCCCACCCGCTGTCCCCCTATGGGGGCAGAAAAGCAATAATGTCCAG
   2240
2241   
GGGCAGGCAGGGGCCCTTGGGAGCTGCAGGGCTGGGGGTTAGGGCTGCTCCCTGGTGAATGGAGTCAGAT
   2310
2311   
CCTAGGATCTGTACCATGGGGAACCAGGAGTGGCCGGGCTGGGTGCCGCCTCCTGGTCCGGCCTCCTCCC
   2380
2381   
CACCAAACTGTCCTCACCCTATGGATGAGGCAGGAGGAACATTTGGGGCCAAACCTGCCTGCCTCCCAGC
   2450
2451   
CCCGTGCCTTACTAGGGCTTCCTTCCAGCTGGCCTTACCTCCCGCTGGACCCTGGGCCTGGCCTGGCCCC
   2520
2521   
ACTGGGGGCTATGGGCTGGGCTCACCCTCTCCTCTGCGGGGGTGGAGGGCCACCAGCCTTGGCTGTTACA
   2590
2591   
ATCTTACACCGGACAGTATTGGGCCCCATGGACTTGGTCAGGGAGGGGTGGGGGTGGGCATCTCTGGTAC
   2660
2661   
CTATTGGGGTGGGGGGCCTCTGAAAAGGGAGGCTCCTAGGCCCCCCTCACCCCTCCCTCTCCCCAGGGCC
   2730
2731   
CCACGTTCTGCAGCCTTAAGGTTGAACATGAGTGCACGTCCATGTCAGTGCTGTGGGACTCCTGTGCGTG
   2800
2801   
CCTCGGACTGCGTGTGTCGGCGGGACGCAGGCACACGTGGGTGTGTGTGCATGTGTGTTTGTGTGAGGGC
   2870
2871   
AGCGTGTCCTCCAGTGTGCATGGTGTGTGGGCTTGGGCCCCATCCCTGGCCCGAGCATTTCATCCTGTGG
   2940
2941   
GGGAGGGGTGCTGACCTAGTGGGAGGAGCCCCACTGTGATCCATGAGCTGCCCTGCCCACGCCTCCCCTC
   3010
3011   
CCTGTAGCAACACCTCTGGGTGTTTGGAGTTTAGCTTTTGTGGGTTTGCTCTCCCTATCCCATCTCCTGT
   3080
3081   
ACTACACAGTTCATGGCAGGGTGGGGAGGGGTGGGGTTGGTTCGGGTGGGTGAGGGTCTTTTTCCTCTGT
   3150
3151   
GTGCGATGTTGTTATCTGACAGTTCTCCGTCCCTACTGGCCTTTCTCCTCGTCTTCATATTTGTACGGTA
   3220
3221   
CAAGCAATAAAGACACTCATTTCAGACCAGGGCCCAGCCTGCACTCACGCCAGCCCAACCACTCTGGGCT
   3290
3291   
TTGCCTTGGTGATGGAGTCAGACCCCTGGGCCCCAGCTCCTCCTGTACTAGCCGTTCCCTTCAGCAAGGA
   3360
3361   
GGGCACTGAGCTCAGGGTGAGGGCAGCTGGGGTGTGTGCAGGAGCTCAGGCTGGAGAGGGTGGGTGGAGC
   3430
3431   
TGGTGCTGTGGGGCTGAGGGGTATGGGAAGGCTCCCCGCATGTGGGGGTGGGGTGGACAGAGACCACTCC
   3500
3501   
AGGCCCTCAGTGCTGCTTAGGCTAAGAGAGGTGGGGTGGAGGGACAGGGCTGGAAGATCTGGGTAGCCCA
   3570
3571   
GAATGAGGAGGGTGCCTGTGCTGTCACTGAATGAGAGGGAGTGGTTCATTCCACCCGGCTGCCGAGCCTC
   3640
3641   
AGAGGGGGGCATTCCTATCCTGCCCCACCTCCCTGTTTATGCTGCCACCTGGAAGCCTTGAGGCCCCCAA
   3710
3711   
ATTCCAGTACAGACCCAGTGGTGTGTTCATGGTGGCGTGGTTGCTGTCACCTGGGAGCTCCTGAGCGTTT
   3780
3781   
GGTTAGAACCCTGTTCAGCTTGGGGTCAGCCCTCCCCTAGTCACTGCCCTTTAGCCTGGATGTGTCTGGG
   3850
3851   
CCCCTGCACTTCCCGTGCTTGAGTCACGTGGCTGCATGGCCGGGCGCTGGCCGGATGGAACACCTCCCCC
   3920
3921   
AGCAAGGGACCAGGGACCAGAGCCCTGGCCTGCCCTGCTGAGCCCTGCTGTGCAGAGGGCCTGGCACAGA
   3990
3991   
TGAATTTGAGATTTTGCCGCAAGGTGTTAGCACTTCACACCCATTGAGTCTTTGAGATTTTAAGTGAATG
   4060
4061   
TAAGCAGAAAAAGTCAGATCCAATTTACAGAAATCAGAGTTAGCTACAGCTAGGACTCGTTTGGTTGGGG
   4130
4131   
TTTTTTAGTTTGTCTTTCTAAAGTCATGTGGACCTTAATTTAATTACAAAAGTCTACCCTGGTGGTCATA
   4200
4201   
AAATAGGCAGGCCTATGAAGAAAGGCCTTTTACTCTTCCATCTCATCCCAGCCCCGAGTTGACCCACGTT
   4270
4271   
GCTGCTCCTCACACCATGGTGATGCAGGTCTCGTAGTGTGGGCACAGGCCTGGCTACCTCATCTTTTTAG
   4340
4341   
TGCCTCTCTCCTCTTCCACAGGATGGGGTCCCACAGCTGCAGCAGCTGGCCCCGTAGTTGAGCATGTGTG
   4410
4411   
GTTATCCTGTAGAGCTTTTCCCAAGAAGGGTGTTTGAACTTAGAGTCTTAATAAAATCTTACCAAATAAA
   4480
4481   
TTTTGAGTAGAATAATCGTCTTTTGCAATGTACATTTTAAAAATTTCACACATTCTTTTTTGTATATAAA
   4550
4551   
GAACAGTGACTGGGCACAGTGGCTCATGCCTGTAATCCCAGCAATTTGGGAGGCCGAGGCGGGCGGGTCT
   4620
4621   
CTTGAGGCCAGGGGTTCGAGACCAGCCTGGGCATCATAGGGAGACCTTCATCTCTACAAAAAATACAAAA
   4690
4691   
ATTAGCTGGGCATGGTGGTGCATGCCTGCAATCCCAGCTAACTTGGAAGGCTGAGGTGAGGTGGGAAGAT
   4760
4761   
CACTTGAGCCCAGGAGTTTGAGGCTGCAGTGAGCTATGATTGCGGCACTGCACTGCAGCCTGGGACAATG
   4830
4831   
AGACTGTGTCTCTAAAAATAAAAAAAAAAAAAACATGATACATGCTATTAAAAAAGACAGCAAAGCAGGA
   4900
4901   
GTATAAGAAAGGAAATTCACCCGAGGTCGCAGGGCCTTGAGTACTCATTTTGGTGCTGATTACCTCTCTG
   4970
4971   
CAAATGGACACGGCATCATAAATTGGTAGTTTCCTGCTCTTTTTGTGTAATCTTTTCCAGTTAATGTGAA
   5040
5041   
GCCTCTGGGGGCTGCCCTCGTGCACTGATGGTTGTGTGGAGTCGGGGGCGGCAGTGCGATTCCCTTTTAG
   5110
5111   
CTGCTGCATGGGGGGAACTCAGGCTTTCCAGCTGCTTCCTGGGGTTCCATGGGGTAGACCCCTCAACCGC
   5180
5181   
TTCAGCTGCCCCGTTAACAGGAATTGACTTGGTTTCGTTTGGTGCTACCAGCAGTCCTGTAATAAACTAG
   5250
5251   
CTATCCATCTGTA
   5263