The graphical view of miRNA target site on the transcript.


Exon boundary/UTR region/CDS region on the transcript
   
AK055779 Sequence View
hsa-miR-16  
miRNA target sites relative to the transcript

Summary miRNA target site
miRNA Pos. on Gene Transcript (Tx.) Pos. on Tx. Tx. Region Exon Type Conservation Target
Accessibility
MFE Alignment Score Alignment Seed Type
5'UTR CDS 3'UTR CS AS
hsa-miR-16 51841 - 51863 AK055779 2128 - 2150       0.000 0.000 -14.70  123.00
 miRNA 3'-gcgguuauaaaUGC-ACGACGau-5'
                  :|| ||||||  
  mRNA 5'-ugucugccuccGCGCUGCUGCau-3'
Offset 6mer
hsa-miR-16 52049 - 52069 AK055779 2336 - 2356       0.000 0.000 -13.00  123.00
 miRNA 3'-gcGGUUAUAAAUGCACGACGAu-5'
         |::: : ||| | |||||| 
  mRNA 5'-ggCUGGGGGUUA-GGGCUGCUc-3'
6mer
*CS: constitutively spliced exon
*AS: alternatively spliced exon

The sequence view of miRNA target site on the transcript.


Transcript sequence
1   
ATTCAAGGCTCAGGGTGGTGGCTCATTTTCAAGGGGCTGTGAAAAGAGAGGGTCACTCCTTTTTGATCAT
   70
71   
TTCCCTGCTGCCTGGCTTCAAATGGCCCTCAGGCCAGGTCACTTTAGGGAAATTGGTGATCGCTCTTGGT
   140
141   
ATTCCACTTTTTTTTTTTTTTTGAGACGGAGTCTCGCACTGTCACCAGGCTGGAGTGCAGTGGTGCGATC
   210
211   
TCTGCTCACTGCACCCTCCGCCTCCCGGGTTCAAGCAATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGA
   280
281   
TTAGGCGAATGCCACCCCTGACTAATTTTTGTATTTTTAGTAGAGACGGGGTTTCACCATGTTGGCCAGG
   350
351   
CTGGTCTCGAACTCCTGACCTTGTGATCCATCCGCCTCAGCCTCCCAAAGTGCTGGGATTATAGGCATGA
   420
421   
GCCACTGCGCCTGGCGTGGAATTTCACTCAGGTCCCTTCAGCTCTCTCTGGTTCTGACAGATCTTGCCCA
   490
491   
AATTCCCATGGTTATGTGGTCATTTGCTTGCCTGTTGCTGGGGGTGGCTGGGAGGTGGCACTCAGCTGTT
   560
561   
CGACTCTGAGGCCCAGGACTCCTGGCTGCTGGGACTCACGTGTGTCCCTGCACAGGGAGGAGTGGATGCG
   630
631   
GGCCATCCAGATGGTCGCCAACAGCCTCAAGCAGCGGGCCCCAGGCGAGGACCCCATGGACTACAAGTGT
   700
701   
GGCTCCCCCAGTGACTCCTCCACGACTGAGGAGATGGAAGTGGCGGTCAGCAAGGCACGGGCTAAAGTGA
   770
771   
CCATGAATGACTTCGACTATCTCAAACTCCTTGGCAAGGGAACCTTTGGCAAAGTCATCCTGGTGCGGGA
   840
841   
GAAGGCCACTGGCCGCTACTATGCCATGAAGATCCTGCGGAAGGAAGTCATCATTGCCAAGGATGAAGTC
   910
911   
GCTCACACAGTCACCGAGAGCCGGGTCCTCCAGAACACCAGGCACCCGTTCCTCACTGCGCTGAAGTATG
   980
981   
CCTTCCAGACCCACGACCGCCTGTGCTTTGTGATGGAGTATGCCAACGGGGGTGAGCTGTTCTTCCACCT
   1050
1051   
GTCCCGGGAGCGTGTCTTCACAGAGGAGCGGGCCCGGTTTTATGGTGCAGAGATTGTCTCGGCTCTTGAG
   1120
1121   
TACTTGCACTCGCGGGACGTGGTATACCGCGACATCAAGCTGGAAAACCTCATGCTGGACAAAGATGGCC
   1190
1191   
ACATCAAGATCACTGACTTTGGCCTCTGCAAAGAGGGCATCAGTGACGGGGCCACCATGAAAACCTTCTG
   1260
1261   
TGGGACCCCGGAGTACCTGGCGCCTGAGGTGCTGGAGGACAATGACTATGGCCGGGCCGTGGACTGGTGG
   1330
1331   
GGGCTGGGTGTGGTCATGTACGAGATGATGTGCGGCCGCCTGCCCTTCTACAACCAGGACCACGAGCGCC
   1400
1401   
TCTTCGAGCTCATCCTCATGGAAGAGATCCGCTTCCCGCGCACGCTCAGCCCCGAGGCCAAGTCCCTGCT
   1470
1471   
TGCTGGGCTGCTTAAGAAGGACCCCAAGCAGAGGCTTGGTGGGGGGCCCAGCGATGCCAAGGAGGTCATG
   1540
1541   
GAGCACAGGTTCTTCCTCAGCATCAACTGGCAGGACGTGGTCCAGAAGAAGCTCCTGCCACCCTTCAAAC
   1610
1611   
CTCAGGTCACGTCCGAGGTCGACACAAGGTACTTCGATGATGAATTTACCGCCCAGTCCATCACAATCAC
   1680
1681   
ACCCCCTGACCGCTATGACAGCCTGGGCTTACTGGAGCTGGACCAGCGGACCCACTTCCCCCAGTTCTCC
   1750
1751   
TACTCGGCCAGCATCCGCGAGTGAGCAGTCTGCCCACGCAGAGGACGCACGCTCGCTGCCATCACCGCTG
   1820
1821   
GGTGGTTTTTTACCCCTAACTTTTTACTTAGCCTTTTTGGTTTGTGTCCCCACCCCCACCTCCTCACCCC
   1890
1891   
CTTTCCAGTTCTTCTTCAGGCCCCTCCCAGACGCACCCCAGCGGCCCCTGCAGCCCCTGCCTCCAGCCTC
   1960
1961   
CAGCCTCACCTTTGTGCCCAGACTCGCATTTGGAAGACTCCACCTCCCGCCCAGGCCTGGGCTGTTGGGC
   2030
2031   
GGTTGGAGACTCAGGTTTTAATCCACACAAGCCCCAGTGAGGGGCGAAGCATGGCGCCTGGGGCCTGCCT
   2100
2101   
GAGTTTCTGGCCTGGGTGTCGTGCTGGTGTCTGCCTCCGCGCTGCTGCATCTGGACGAAGGCTGCCTTCT
   2170
2171   
GGTGGGACGCGACACCCGGCAGACAGTGGTGCTGCCTTCCAGGCCCCGTGGCCTAGGCTCGGAGTGGCCA
   2240
2241   
GGCACGGGGCGGTCCAATCCCCCACCCGCTGTCCCCCTATGGGGGCAGAAAAGCAATAATGTCCAGGGGC
   2310
2311   
AGGCAGGGGCCCTTGGGAGCTGCAGGGCTGGGGGTTAGGGCTGCTCCCTGGTGAATGGAGTCAGATCCTA
   2380
2381   
GGATCTGTACCATGGGGAACCAGGAGTGGCCGGGCTGGGTGCCGCCTCCTGGTCCGGCCTCCTCCCCACC
   2450
2451   
AAACTGTCCTCACCCTATGGATGAGGCAGGAGGAACATTTGGGGCCAAACCTGCCTGCCTCCCAGCCCCG
   2520
2521   
TGCCTTACTAGGGCTTCCTTCCAGCTGGCCTTACCTCCCGCTGGACCCTGGGCCTGGCCTGGCCCCACTG
   2590
2591   
GGGGCTATGGGCTGGGCTCACCCTCTCCTCTGCGGGGGTGGAGGGCCACCAGCCTTGGCTGTTACAATCT
   2660
2661   
TACACCGGACAGTATTGGGCCCCTCCCTCTCCCCAGGGCCCCACGTTCTGCAGCCTTAAGGTTGAACATG
   2730
2731   
AGTGCACGTCCATGTCAGTGCTGTGGGACTCCTGTGCGTGCCTCGGACTGCGTGTGTCGGCGGGACGCAG
   2800
2801   
GCACACGTGGGTGTGTGTGCATGTGTGTTTGTGTGAGGGCAGCGTGTCCTCCAGTGTGCATGGTGTGTGG
   2870
2871   
GCTTGGGCCCCATCCCTGGCCCGAGCATTTCATCCTGTGGGGGAGGGGTGCTGACCTAGTGGGAGGAGCC
   2940
2941   
CCACTGTGATCCATGAGCTGCCCTGCCCACGCCTCCCCTCCCTGTAGCAACACCTCTGGGTGTTTGGAGT
   3010
3011   
TTAGCTTTTGTGGGTTTGCTCTCCCTATCCCATCTCCTGTACTACACAGTTCATGGCAGGGTGGGGAGGG
   3080
3081   
GTGGGGTTGGTTCGGGTGGGTGAGGGTCTTTTTCCTCTGTGTGCGATGTTGTTATCTGACAGTTCTCCGT
   3150
3151   
CCCTACTGGCCTTTCTCCTCGTCTTCATATTTGTACGGTACAAGCAATAAAGACACTCATTTC
   3213