The graphical view of miRNA target site on the transcript.


Exon boundary/UTR region/CDS region on the transcript
   
AK304209 Sequence View
hsa-miR-15a  
miRNA target sites relative to the transcript

Summary miRNA target site
miRNA Pos. on Gene Transcript (Tx.) Pos. on Tx. Tx. Region Exon Type Conservation Target
Accessibility
MFE Alignment Score Alignment Seed Type
5'UTR CDS 3'UTR CS AS
hsa-miR-15a 45565 - 45583 AK304209 1198 - 1216       0.151 0.001 -12.80  135.00
 miRNA 3'-guguuugGUAAUACACGA-CGAu-5'
              |||||| |||| ||| 
  mRNA 5'-----ucaCAUUAUUUGCUGGCUg-3'
None
*CS: constitutively spliced exon
*AS: alternatively spliced exon

The sequence view of miRNA target site on the transcript.


Transcript sequence
1   
GAGTGTGGGAGGGGCGCTGGGTGGGAGCTCAGCCTGGCCCCCTTGGGGCAGGACCCACTGCCAACTCGGC
   70
71   
ACCCACAGCAGGGCCCAGGTGCTCTGACTGTGCCGAGCGAGGGACAGCAAGCCGGGTCGGCCAAGAGGAG
   140
141   
ACTGCATGTCAGAGGTCCCAGCAGGAGTTTCTTCAGCCCAGCCGTCCTGCTGGAGAAGCTCGTTCGCAGA
   210
211   
TGTTGTTTCTAAGGACTGTGCCCTGTCCACGGTGCCTCCTGCATGTCCTGCTGCCCTGAGCTGTCCCGAG
   280
281   
CTAGGTGACAGCGTACCACGCTGCCACCATGAATGAGGTGTCTGTCATCAAAGAAGGCTGGCTCCACAAG
   350
351   
CGTGGTGAATACATCAAGACCTGGAGGCCACGGTACTTCCTGCTGAAGAGCGACGGCTCCTTCATTGGGT
   420
421   
ACAAGGAGAGGCCCGAGGCCCCTGATCAGACTCTACCCCCCTTAAACAACTTCTCCGTAGCAGAATGCCA
   490
491   
GCTGATGAAGACCGAGAGGCCGCGACCCAACACCTTTGTCATACGCTGCCTGCAGTGGACCACAGTCATC
   560
561   
GAGAGGACCTTCCACGTGGATTCTCCAGACGAGAGGGAGGAGTGGATGCGGGCCATCCAGATGGTCGCCA
   630
631   
ACAGCCTCAAGCAGCGGGCCCCAGGCGAGGACCCCATGGACTACAAGTGTGGCTCCCCCAGTGACTCCTC
   700
701   
CACGACTGAGGAGATGGAAGTGGCGGTCAGCAAGGCACGGGCTAAAGTGACCATGAATGACTTCGACTAT
   770
771   
CTCAAACTCCTTGGCAAGGGAACCTTTGGCAAAGTCATCCTGGTGCGGGAGAAGGCCACTGGCCGCTACT
   840
841   
ACGCCATGAAGATCCTGCGGAAGGAAGTCATCATTGCCAAGGATGAAGTCGCTCACACAGTCACCGAGAG
   910
911   
CCGGGTCCTCCAGAACACCAGGCACCCGTTCCTCACTGTGAGTTGCCCTCCCCTTCCCAGACAGTGTGAG
   980
981   
GCCAGCCTTTGGACAGAGCTCAGAGAGAGAGCCCTAATCTTCTGGTACAAAGCACAGTCTTGGGGTAGGC
   1050
1051   
CAGGCGGGCAGGGCAAGGTGTTGCTGCGCCCTGCCAAGTCATCCGAACCAAGACATGTGGTGGGGGTGAG
   1120
1121   
CAGGCTCGGGGAGTGGGAGGGTGACAGCTTCTTCATAGATGGTGGCTTCATGTAAGCATTTGAACTAACT
   1190
1191   
GAAGATATCACATTATTTGCTGGCTGCTGTCTCTATGAGTTAGGAGCACTTAGCCCAGCTGGTTGAAGTG
   1260
1261   
GAAACATTATTTTTTTTGTTTTTGTTTTCAGATATGCTCATAGAAGCAGATGTGTTAGCATTGTGTTGTC
   1330
1331   
TGTCAGCCTGGACTGAGTAGATGCCTGTTTGGGCTGCAGTCTCCATCAAGGCCAGTGGCCACCAGTTAAA
   1400
1401   
TG
   1402